$25.00

mt26 (14248 - 14911)
[mt26]

mt26 (14248 - 14911)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 14248
End Coverage: np 14911

Primers:
mt26_F: GCCCATAATCATACAAAGCCC
mt26_R: GGTTGAGGCGTCTGGTGAG

Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies