$25.00

mt28 (15393 - 16048)
[mt28]

mt28 (15393 - 16048)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 15393
End Coverage: np 16048

Primers:
mt28_F: TAGGAATCACCTCCCATTCC
mt28_R: TGAGTCAATACTTGGGTGGTACC

Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies