Top » Catalog » SNPs » Z284

16.49€

Z284
[Z284]

Z284
hg38 Position: ChrY:8849155..8849155
Ancestral: C
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b1a3
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z284_F TTACCAAATATCATGCTTTCTACAGTATATTAC
Reverse Primer: Z284_R TGCATCAAATACTGCTGCAC
Reviews

Customers who bought this product also purchased
YP5585
YP5585
YP1451
YP1451
Z282
Z282
Z94
Z94
KMS133
KMS133
Z288
Z288
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies