Top » Catalog » SNPs » Z284

15.65€

Z284
[Z284]

Z284
hg38 Position: ChrY:8849155..8849155
Ancestral: C
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b1a3
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z284_F TTACCAAATATCATGCTTTCTACAGTATATTAC
Reverse Primer: Z284_R TGCATCAAATACTGCTGCAC
Reviews

Customers who bought this product also purchased
M343
M343
R1a-L664 Panel
R1a-L664 Panel
S3485
S3485
M173
M173
L122
L122
YP5530
YP5530
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies