Top » Catalog » SNPs » BY78581

16.49€

BY78581
[BY78581]

BY78581
hg38 Position: ChrY:9313585..9313585
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: Below SK1357
Forward Primer: BY78581_F TTTTTTTATTATACTTTAAGTTCTAGGGTACACA
Reverse Primer: BY78581_R ACTCATCATGCACATGTATCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies