Top » Catalog » SNPs » Z38463

15.65€

Z38463
[Z38463]

Z38463
hg38 Position: ChrY:8416819..8416819
Ancestral: G
Derived: C
Reference: Chris Rottensteiner (2015)
ISOGG Haplogroup: J2a1
Comments: PH2651
Forward Primer: Z38463_F TGGTAGCAACACTGCACCTC
Reverse Primer: Z38463_R AGCTAGAACGCTGGAACCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies