Top » Catalog » SNPs » FGC36918

$18.00

FGC36918
[FGC36918]

FGC36918
hg38 Position: ChrY:20626460..20626460
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of Z71
Forward Primer: FGC36918_F TATATTCACTGCTGTGTGGAAGC
Reverse Primer: FGC36918_R GACACAGAGACCAGGGGAATAC
Reviews

Customers who bought this product also purchased
FGC41997
FGC41997
FGC41996
FGC41996
FGC41995
FGC41995
A9862
A9862
A8380
A8380
FGC36896
FGC36896
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies