Top » Catalog » B » V75

$18.00

V75
[V75]

V75
hg38 Position: ChrY:15309469..15309469
Ancestral: G
Derived: A
Reference: Cruciani et al 2011
ISOGG Haplogroup: B (Investigation)
Comments: Approx hg: B
Forward Primer: V75_F CCAAAACTGGTTTTTTAATGCAG
Reverse Primer: V75_R AATCTCATCTATCTTGTTAATTGCTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies