Top » Catalog » B » L1395

$18.00

L1395
[L1395]

L1395
hg38 Position: ChrY:19721039..19721039
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: B3
Comments: Found in a hg B-M60 WTY participant
Forward Primer: L1395_F CACCATGGGACATCAAAGTG
Reverse Primer: L1395_R TTGGAACCTGAATGTGATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies