Top » Catalog » B » L1396

$19.00

L1396
[L1396]

L1396
hg38 Position: ChrY:21081873..21081873
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: B3
Comments: Found in a hg B-M60 WTY participant
Forward Primer: L1396_F TTTCAGAGAAGCTGGTGACG
Reverse Primer: L1396_R TGCCTTCAGGCGTAAGATTC
Reviews

Customers who bought this product also purchased
Z11616
Z11616
Z11517
Z11517
L1392
L1392
L1391
L1391
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies