Top » Catalog » B » Z11607

$18.00

Z11607
[Z11607]

Z11607
hg38 Position: ChrY:15733766..15733766
Ancestral: T
Derived: A
Reference: Bonnie Schrack (2014)
ISOGG Haplogroup: B3 (not listed)
Comments: .
Forward Primer: Z11607_F TGAACCATTTCACGGGTTAAG
Reverse Primer: Z11607_R GTGGCCAATTTAGCACACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies