Top » Catalog » B » Z5263

$18.00

Z5263
[Z5263]

Z5263
hg38 Position: ChrY:8129350..8129350
Ancestral: T
Derived: C
Reference: Ray Banks (2015)
ISOGG Haplogroup: B (not listed)
Comments: New clade parallel to B1 & B2
Forward Primer: Z5263_F GGTGCTAAGAATGCTGTTGAATG
Reverse Primer: Z5263_R GAATTGGAAGTAATTCCATTAATAGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies