Top » Catalog » B » Y33076

$18.00

Y33076
[Y33076]

Y33076
hg38 Position: ChrY:21120416..21120416
Ancestral: A
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: B2a1a1a1a~ (not listed)
Comments: Below FGC51175.
Forward Primer: Y33076_F AGATGCAGGGGAGACTGATG
Reverse Primer: Y33076_R TCAAGGCTTGTTCTTTCACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies