Top » Catalog » C » M130

$18.00

M130
[M130]

M130
hg38 Position: ChrY:2866813..2866813
Ancestral: C
Derived: T
Reference: Underhill et al.
ISOGG Haplogroup: C
Comments: aka RPS4Y
Forward Primer: M130_F TCTCAGGAGACATGTATAAGGAAGTG
Reverse Primer: M130_R GACAGTGCCAAAATCATGAGC
Reviews

Customers who bought this product also purchased
L844
L844
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies