Top » Catalog » C » F725

$18.00

F725
[F725]

F725
hg38 Position: ChrY:2869421..2869421
Ancestral: C
Derived: T
Reference: Yan Shi (2011)
ISOGG Haplogroup: C1b1a2b
Comments: Found in a hg C person. Likely a singleton.
Forward Primer: F725_F CCTATCCATTGCCACTGTCAC
Reverse Primer: F725_R GCCTGAGGGCTCCATCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies