Top » Catalog » C » A14919

$18.00

A14919
[A14919]

A14919
hg38 Position: ChrY:20456604..20456604
Ancestral: G
Derived: T
Reference: Xin Lu (2017)
ISOGG Haplogroup: C
Comments: Below CTS2657
Forward Primer: A14919_F TCTTTGAGGAAAACGGGATG
Reverse Primer: A14919_R AGGGATGCTTTGGAAATGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x AM00760
1 x AM00790
$36.00
Haplogroup Info
Other products
Currencies