Top » Catalog » D » A24029

$18.00

A24029
[A24029]

A24029
hg38 Position: ChrY:13611329..13611329
Ancestral: G
Derived: T
Reference: Xin Lu (2019)
ISOGG Haplogroup: D
Comments: Below F1031
Forward Primer: A24029_F TAAAAGTCCCTCTATACATAAAACCTG
Reverse Primer: A24029_R GCAGCAGGTGTGGTTTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A24031
1 x Y14814
1 x Y15398
1 x Z27287
1 x Y71812
1 x BY12878
1 x Y20058
1 x Z3722.1
1 x Z41027
1 x BY12770
1 x Z3755
1 x F22642
1 x Z14843
1 x Z40999
1 x P153
1 x CTS6969
1 x Z27276
$306.00
Haplogroup Info
Other products
Currencies