Top » Catalog » D » A24029

$18.00

A24029
[A24029]

A24029
hg38 Position: ChrY:13611329..13611329
Ancestral: G
Derived: T
Reference: Xin Lu (2019)
ISOGG Haplogroup: D
Comments: Below F1031
Forward Primer: A24029_F TAAAAGTCCCTCTATACATAAAACCTG
Reverse Primer: A24029_R GCAGCAGGTGTGGTTTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies