Top » Catalog » D » A24030

$18.00

A24030
[A24030]

A24030
hg38 Position: ChrY:13832392..13832392
Ancestral: C
Derived: T
Reference: Xin Lu (2019)
ISOGG Haplogroup: D
Comments: Below F1031
Forward Primer: A24030_F GACCAATTAGCCCTCTGTAAAATG
Reverse Primer: A24030_R TTACATGAGTAAGTTCCTTACTGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y12553
1 x F23586
1 x CTS504
1 x Page3
$72.00
Haplogroup Info
Other products
Currencies