Top » Catalog » D » A24031

$18.00

A24031
[A24031]

A24031
hg38 Position: ChrY:16107701..16107701
Ancestral: C
Derived: A
Reference: Xin Lu (2019)
ISOGG Haplogroup: D
Comments: Below F1031
Forward Primer: A24031_F AAGAGAAAACTGCATAAATAACCTAATTTAG
Reverse Primer: A24031_R GGTTTTTGCAGGTCTGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x MF2333
1 x CTS7590
1 x MF2323
1 x Y80841
1 x CTS217
1 x Z27289
1 x Z3723
$126.00
Haplogroup Info
Other products
Currencies