Top » Catalog » D » A24033

$18.00

A24033
[A24033]

A24033
hg38 Position: ChrY:17308294..17308294
Ancestral: C
Derived: A
Reference: Xin Lu (2019)
ISOGG Haplogroup: D
Comments: Below F1031
Forward Primer: A24033_F GTAAAGCTTTGTAACCTCAGTCAAGG
Reverse Primer: A24033_R CTATCAGCAATGAGTGCTTTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z41238
1 x Z31543
1 x CTS107
1 x Z34164
1 x M174
1 x Z18592
1 x Z31526
1 x Z34364
1 x A8947
1 x Z18539
1 x CTS5058
1 x Z1500
1 x Z34280
1 x Z29933
1 x Y14757
1 x Y137849
1 x F1278
1 x Z3839
1 x F17210
1 x BY12737
1 x CTS8057
$378.00
Haplogroup Info
Other products
Currencies