Top » Catalog » D » Y14864

$18.00

Y14864
[Y14864]

Y14864
hg38 Position: ChrY:19949086..19949086
Ancestral: C
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: D
Comments: Equiv. to P99
Forward Primer: Y14864_F TGCACTATTGAATTTTGTTTCCTACTAC
Reverse Primer: Y14864_R GAAAAAGTGATAAGCCACTAGTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z42439
1 x A24028
1 x Z34259
1 x Z38248
$72.00
Haplogroup Info
Other products
Currencies