Top » Catalog » D » M57

$18.00

M57
[M57]

M57
hg38 Position: ChrY:19590031..19590031
Ancestral: del
Derived: ins
Reference: Underhill et al. 2001
ISOGG Haplogroup: D1b
Comments: G10.85n
Forward Primer: M57_F CTGACAATTGGGAGGAAGTGG
Reverse Primer: M57_R CATGGAGTTGCTGCTTTAACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ACT5062
1 x Z18570
1 x Z27311
$54.00
Haplogroup Info
Other products
Currencies