Top » Catalog » D » Z31624

$18.00

Z31624
[Z31624]

Z31624
hg38 Position: ChrY:19443307..19443307
Ancestral: C
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: D1a1a2
Comments: Equiv to F1070
Forward Primer: Z31624_F GGTCAAGGGCAGAAACTGAC
Reverse Primer: Z31624_R ATCACAGGGGGTTCACTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY4463
1 x BY5650
1 x BZ1268
1 x A13143
1 x Page36
1 x A12499
$108.00
Haplogroup Info
Other products
Currencies