Top » Catalog » D » Z31624

$18.00

Z31624
[Z31624]

Z31624
hg38 Position: ChrY:19443307..19443307
Ancestral: C
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: D1a1a2
Comments: Equiv to F1070
Forward Primer: Z31624_F GGTCAAGGGCAGAAACTGAC
Reverse Primer: Z31624_R ATCACAGGGGGTTCACTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z40646
1 x CTS356
1 x Z43904
1 x Z38478
1 x F21290
1 x CTS2728
1 x Z34192
1 x Z43932
$144.00
Haplogroup Info
Other products
Currencies