Top » Catalog » D » Z40955

$18.00

Z40955
[Z40955]

Z40955
hg38 Position: ChrY:7129703..7129703
Ancestral: A
Derived: T
Reference: Ray Banks (2016)
ISOGG Haplogroup: D
Comments: Down from F1070 Aka BY12694
Forward Primer: Z40955_F TTTAAAGGCTAAACCAAATTTGAAC
Reverse Primer: Z40955_R GTTGACAGGTGCAACACACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies