Top » Catalog » D » Z40955

$18.00

Z40955
[Z40955]

Z40955
hg38 Position: ChrY:7129703..7129703
Ancestral: A
Derived: T
Reference: Ray Banks (2016)
ISOGG Haplogroup: D
Comments: Down from F1070 Aka BY12694
Forward Primer: Z40955_F TTTAAAGGCTAAACCAAATTTGAAC
Reverse Primer: Z40955_R GTTGACAGGTGCAACACACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z14852
1 x CTS4572
1 x Z34163
1 x Z43924
1 x BY12984
1 x Y14780
1 x P53.2
1 x M5528.1
1 x Y137829
1 x CTS1964
1 x F20594
1 x Z40981
1 x F16508
1 x Z18558
1 x SK538
1 x Z39599
1 x Y73322
1 x Z41239
1 x MF2334
1 x Y14797
$360.00
Haplogroup Info
Other products
Currencies