Top » Catalog » D » N1

$18.00

N1
[N1]

N1
hg38 Position: ChrY:12739592..12739592
Ancestral: C
Derived: G
Reference: Deng et al. 2004
ISOGG Haplogroup: D1a1a1
Comments: Downstream M15 > F901
Forward Primer: N1v2_F AGTTGCCAGGTATTAAATGACAG
Reverse Primer: N1v2_R CAATGACCAATTCTTTTTCATCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x CTS3033
1 x Z41207
1 x Z42442
1 x Z38292
$72.00
Haplogroup Info
Other products
Currencies