Top » Catalog » D » P99

$18.00

P99
[P99]

P99
hg38 Position: ChrY:12774452..12774452
Ancestral: C
Derived: T
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: D1a2
Comments: DFFRY AluY50
Forward Primer: P99_F CGTGGTGGTAGGTTCCTTTAG
Reverse Primer: P99_R TGAGCATGCAACATTTATTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z3764
1 x Z43909
1 x Z40583
1 x Y62194
1 x Z44025
1 x Y14753
$108.00
Haplogroup Info
Other products
Currencies