Top » Catalog » D » Z34364

$18.00

Z34364
[Z34364]

Z34364
hg38 Position: ChrY:15375700..15375700
Ancestral: C
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: D1a2a1b~
Comments: subgrp under M533
Forward Primer: Z34364_F AGCAGCTAGACTGACCAAGG
Reverse Primer: Z34364_R CATGCTTCAAGGACTGATTGC
Reviews

Customers who bought this product also purchased
M533
M533
M174
M174
Z34227
Z34227
D-M174 Panel
D-M174 Panel
Z42600
Z42600
Z34359
Z34359
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y14816
1 x Z40992
1 x Z27343
1 x P37.1
1 x BY12751
1 x Z14786
1 x Z40691
1 x F19825
1 x Z38261
1 x Z35641
1 x Z34303
1 x Y14865
1 x Z17259
1 x BY12824
1 x MF2294
1 x Z27338
1 x CTS6394
$306.00
Haplogroup Info
Other products
Currencies