Top » Catalog » D » CTS10649

$18.00

CTS10649
[CTS10649]

CTS10649
hg38 Position: ChrY:20514686..20514686
Ancestral: C
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: D1b1a2b1a1a3~
Comments: Extracted from 1000 genomes data. Not qualified. Below FGC6373
Forward Primer: CTS10649_F AGATGTGGTTCCTCCTCCAG
Reverse Primer: CTS10649_R AACCGAGGAAATCCAGGTTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x P42
1 x Z41261
1 x Y14833
1 x F15749
1 x BY12705
1 x CTS3391
$108.00
Haplogroup Info
Other products
Currencies