Top » Catalog » D » CTS6609

$18.00

CTS6609
[CTS6609]

CTS6609
hg38 Position: ChrY:14896817..14896817
Ancestral: A
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: D1b1c
Comments: Extracted from 1000 genomes data. Not qualified. Below M116.1
Forward Primer: CTS6609_F GGGGCAAAGAGCACTGAC
Reverse Primer: CTS6609_R AATGGCTTTCAAGGAACAAGTG
Reviews

Customers who bought this product also purchased
M125
M125
CTS8532
CTS8532
CTS8093
CTS8093
Z3611
Z3611
CTS2728
CTS2728
IMS-JST006841
IMS-JST006841
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A24029
$18.00
Haplogroup Info
Other products
Currencies