Top » Catalog » D » FGC6373

$18.00

FGC6373
[FGC6373]

FGC6373
hg38 Position: ChrY:2908497..2908497
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: D1b1a2b1a1a1
Comments: Below CTS8093
Forward Primer: FGC6373_F TTTTACCCATGCTGGTCTTG
Reverse Primer: FGC6373_R CCTCTCTCTCCAGAGGGAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F22140
1 x MF2249
1 x F16992
1 x Z14824
1 x Z41046
1 x Y14787
1 x F2455
1 x Z30661
1 x CTS4517
1 x CTS6609
1 x Z42458
1 x F1533
1 x Z41250
$234.00
Haplogroup Info
Other products
Currencies