Top » Catalog » D » FGC6373

$18.00

FGC6373
[FGC6373]

FGC6373
hg38 Position: ChrY:2908497..2908497
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: D1b1a2b1a1a1
Comments: Below CTS8093
Forward Primer: FGC6373_F TTTTACCCATGCTGGTCTTG
Reverse Primer: FGC6373_R CCTCTCTCTCCAGAGGGAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies