Top » Catalog » D » CTS5058

$18.00

CTS5058
[CTS5058]

CTS5058
hg38 Position: ChrY:13882895..13882895
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: D1b1a2b1a1j~
Comments: Extracted from 1000 genomes data. Not qualified. Below CTS8093
Forward Primer: CTS5058_F CATAAATTGCGTTGTTTCGTG
Reverse Primer: CTS5058_R TAAATCAACGCCCCTTCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies