Top » Catalog » D » M174

$18.00

M174
[M174]

M174
hg38 Position: ChrY:12842354..12842354
Ancestral: T
Derived: C
Reference: Underhill et al. 2001
ISOGG Haplogroup: D
Comments: DffryEx38
Forward Primer: M174_F ACATCTCAGATCGTTGTTTGGT
Reverse Primer: M174_R AAAAAGCCATGCAATTACCTG
Reviews

Customers who bought this product also purchased
CTS1828
CTS1828
M533
M533
Z34227
Z34227
D-M174 Panel
D-M174 Panel
Z42600
Z42600
Z34364
Z34364
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z14863
1 x F24738
1 x Z34236
1 x CTS4285
1 x Z1535
1 x BY12781
1 x F18640
1 x A8949
1 x Y15333
1 x Y14868
1 x CTS3335
1 x Z34292
1 x Z40602
1 x SK558
$252.00
Haplogroup Info
Other products
Currencies