Top » Catalog » E » A2227

$18.00

A2227
[A2227]

A2227
hg38 Position: ChrY:8383370..8383370
Ancestral: T
Derived: A
Reference: Hamma Bachir (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below M81 > M5284
Forward Primer: A2227_F CACAATCCCATATATGCGCC
Reverse Primer: A2227_R TTGATAATGACTCTTCTATGGGGAG
Reviews

Customers who bought this product also purchased
V13
V13
L335
L335
M215
M215
E Superclade Panel
E Superclade Panel
Z834
Z834
V22
V22
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies