Top » Catalog » E » A24035

$18.00

A24035
[A24035]

A24035
hg38 Position: ChrY:16681744..16681744
Ancestral: C
Derived: A
Reference: Janet Akaha (2019)
ISOGG Haplogroup: E
Comments: Below FGC7703 > CTS1239 > CTS6667 > Y2862 > Y2881 > Y2873 > CTS8411 > Y32553
Forward Primer: A24035_F CTAACAGGGAACTGCCAAGC
Reverse Primer: A24035_R GGGAGCTCAGAAACACAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1524
1 x A5676
1 x A397
1 x A13642
1 x A20736
1 x Y13972
$108.00
Haplogroup Info
Other products
Currencies