Top » Catalog » E » A24460

$18.00

A24460
[A24460]

A24460
hg38 Position: ChrY:15292002..15292002
Ancestral: A
Derived: G
Reference: Igor Schein (2019)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1b2b1a1b
Comments: Below A12255
Forward Primer: A24460_F AGCTTTAAAAAACAAATAAGGGCG
Reverse Primer: A24460_R CCTTTTTTCCTTGTCTTGTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies