Top » Catalog » E » BY5523

$18.00

BY5523
[BY5523]

BY5523
hg38 Position: ChrY:8616954..8616954
Ancestral: C
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E
Comments: Below BY34331
Forward Primer: BY5523_F AAGTTCACCTGCAAAAAAAATGG
Reverse Primer: BY5523_R AGGCAAAATCCAGACACAGTG
Reviews

Customers who bought this product also purchased
BY5524
BY5524
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A5637
1 x FGC22262
$36.00
Haplogroup Info
Other products
Currencies