Top » Catalog » E » A5868

$18.00

A5868
[A5868]

A5868
hg38 Position: ChrY:16141007..16141011
Ancestral: del
Derived: ins
Reference: Hamma Bachir (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Mutation: GTATA to AAATACGCATCTTGTATATTTGGAAGCCACCTTTGGTATATGA
Forward Primer: A5868_F TTACTTTTATTAATGTTCTCAAGGCAAG
Reverse Primer: A5868_R TGAAAATTTTAAGTAGGCAAGTAACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A786
1 x A16011
1 x FGC64040
$54.00
Haplogroup Info
Other products
Currencies