Top » Catalog » E » CTS1727

$18.00

CTS1727
[CTS1727]

CTS1727
hg38 Position: ChrY:11915035..11915035
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1b (not listed)
Comments: Syn. with CTS12170; downstream CTS10656
Forward Primer: CTS1727v2_F TGGGGTCCTACCAATACATCAG
Reverse Primer: CTS1727v2_R AGACTGAAACTGGCCTTTTCC
Reviews (1)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies