Top » Catalog » E » A6108

$18.00

A6108
[A6108]

A6108
hg38 Position: ChrY:6917494..6917494
Ancestral: C
Derived: G
Reference: Douglas Phelps (2015)
ISOGG Haplogroup: E1a1 (not listed)
Comments: .
Forward Primer: A6108_F TGCAAGGGATTTAGGTTTTG
Reverse Primer: A6108_R CCATTGTCCACTGTGACACC
Reviews

Customers who bought this product also purchased
YFS523985
YFS523985
A10163
A10163
YFS563949
YFS563949
E1a1-Z31503 Phelps Panel
E1a1-Z31503 Phelps Panel
A10162
A10162
YFS563926
YFS563926
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY20093
1 x Y6562
1 x BZ5
1 x Y22328
1 x A10733
1 x Z27287
$108.00
Haplogroup Info
Other products
Currencies