Top » Catalog » E » A6111

$18.00

A6111
[A6111]

A6111
hg38 Position: ChrY:16895436..16895436
Ancestral: G
Derived: C
Reference: Douglas Phelps (2015)
ISOGG Haplogroup: E1a1 (not listed)
Comments: .
Forward Primer: A6111_F ACACCAAATTCAGGCTCCAC
Reverse Primer: A6111_R GCTAGTATGGCGGCAAAGAC
Reviews

Customers who bought this product also purchased
A10163
A10163
YFS563949
YFS563949
E1a1-Z31503 Phelps Panel
E1a1-Z31503 Phelps Panel
A10162
A10162
YFS563926
YFS563926
A10161
A10161
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies