Top » Catalog » E » A6295

$18.00

A6295
[A6295]

A6295
hg38 Position: ChrY:15496858..15496858
Ancestral: G
Derived: A
Reference: Peter Gwozdz (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: divides L540. within V13
Forward Primer: A6295_F AAGAAGGCAGTTGATGAATCTTG
Reverse Primer: A6295_R TTGCAGTCTACATATCTATGTGACTAACA
Reviews

Customers who bought this product also purchased
L540
L540
M35.2
M35.2
Z5018
Z5018
Y7023
Y7023
Z5016
Z5016
A783
A783
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies