Top » Catalog » E » B404

$18.00

B404
[B404]

B404
hg38 Position: ChrY:2909146..2909146
Ancestral: G
Derived: A
Reference: Karmin et al. (2015)
ISOGG Haplogroup: E2
Comments: .
Forward Primer: B404_F CCTCATGGATGACCAAGACC
Reverse Primer: B404_R TGAAAAACAGAAAGGAATGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F19825
1 x BY5151
$36.00
Haplogroup Info
Other products
Currencies