Top » Catalog » E » B405

$18.00

B405
[B405]

B405
hg38 Position: ChrY:6906292..6906292
Ancestral: A
Derived: C
Reference: Karmin et al. (2015)
ISOGG Haplogroup: E1b1b1b2a1a4d2b~
Comments: Below Y6938
Forward Primer: B405_F TCTCTTTGCCTACTGCCATTC
Reverse Primer: B405_R CTGCAGAGGGCTGTGATAAAC
Reviews

Customers who bought this product also purchased
L791
L791
DYS390
DYS390
M34
M34
Y15938
Y15938
Z827
Z827
Y15936
Y15936
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies