Top » Catalog » E » B413

$18.00

B413
[B413]

B413
hg38 Position: ChrY:7144635..7144635
Ancestral: T
Derived: C
Reference: Karmin et al. (2015)
ISOGG Haplogroup: E2
Comments: .
Forward Primer: B413_F TGGGTACTCATGGACATAAGGATAC
Reverse Primer: B413_R GTTTTATAGATGAGCTTGATGACACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY5527
1 x BY5791
1 x A12255
1 x B406
1 x BY8437
$90.00
Haplogroup Info
Other products
Currencies