Top » Catalog » E » L540

$18.00

L540
[L540]

L540
hg38 Position: ChrY:10171129..10171129
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: E1b1b1a1b1a6
Comments: Found in a hg E-V13 WTY participant
Forward Primer: L540_F CCTTCCAAGGTCCTCCTTTC
Reverse Primer: L540_R ATGGGCTGTCTGCTGCTC
Reviews

Customers who bought this product also purchased
A783
A783
Z29042
Z29042
A6295
A6295
Y7026
Y7026
M35.2
M35.2
Y7023
Y7023
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies