Top » Catalog » E » M35

$18.00

M35
[M35]

M35
hg38 Position: ChrY:19579817..19579817
Ancestral: G
Derived: C
Reference: Underhill et al. 2001
ISOGG Haplogroup: E1b1b1
Comments: G to C to T Tri-allelic SNP
Forward Primer: M35_F CCAGGAAAAAGAGAAGTATTAAGCC
Reverse Primer: M35_R TTTTGCCATATGGAGAGCTG
Reviews

Customers who bought this product also purchased
Z1902
Z1902
BY10366
BY10366
V22
V22
L674
L674
V13
V13
Y16563
Y16563
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x CTS10453
$18.00
Haplogroup Info
Other products
Currencies