Top » Catalog » E » A7710

$18.00

A7710
[A7710]

A7710
hg38 Position: ChrY:16825231..16825231
Ancestral: G
Derived: A
Reference: Dug Garrett (2015)
ISOGG Haplogroup: E1a1a1b
Comments: Below Z36090
Forward Primer: A7710_F TGCTAGTAAATTCCAGTCAATTTGG
Reverse Primer: A7710_R CGTGATCCTCCTGCCTTG
Reviews

Customers who bought this product also purchased
Z31497
Z31497
Z17467
Z17467
Z5985
Z5985
CTS9548
CTS9548
M44
M44
Z17696
Z17696
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies