Top » Catalog » E » A7730

$18.00

A7730
[A7730]

A7730
hg38 Position: ChrY:12756268..12756268
Ancestral: T
Derived: C
Reference: Steve Fix (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13 > CTS5856
Forward Primer: A7730_F ACCACTCCAGCAGAATCAGG
Reverse Primer: A7730_R AAAGATCTAGCAACCTGCCAAC
Reviews

Customers who bought this product also purchased
BY153006
BY153006
BY6527
BY6527
BY6279
BY6279
BY6338
BY6338
PF6784
PF6784
M35
M35
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC5943
1 x FGC12832
1 x A12499
1 x BY9874
1 x S9378
1 x Y12645
1 x BY188919
1 x MF669
1 x Y58715
$162.00
Haplogroup Info
Other products
Currencies