Top » Catalog » E » A428

$18.00

A428
[A428]

A428
hg38 Position: ChrY:13494365..13494365
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: E1b1b1b1 (not listed)
Comments: Approx. M183
Forward Primer: A428_F TCTCTTCCCTCATTTTGATTCC
Reverse Primer: A428_R CCTGCTCTTTGCAATTCCTG
Reviews

Customers who bought this product also purchased
MZ89
MZ89
MZ90
MZ90
M81
M81
PF2546
PF2546
MZ143
MZ143
E1b-L19 Panel
E1b-L19 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies