Top » Catalog » E » A428

$18.00

A428
[A428]

A428
hg38 Position: ChrY:13494365..13494365
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: E1b1b1b1 (not listed)
Comments: Approx. M183
Forward Primer: A428_F TCTCTTCCCTCATTTTGATTCC
Reverse Primer: A428_R CCTGCTCTTTGCAATTCCTG
Reviews

Customers who bought this product also purchased
MZ89
MZ89
MZ90
MZ90
M81
M81
PF6794
PF6794
Z5009
Z5009
PF2546
PF2546
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies