Top » Catalog » E » FGC18981

$18.00

FGC18981
[FGC18981]

FGC18981
hg38 Position: ChrY:14930464..14930464
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: E1b (not listed)
Comments: Below L19 > PF2431 > Y11561
Forward Primer: FGC18981_F AACATTGTTCTCAACTGGGAGG
Reverse Primer: FGC18981_R AAAATGTAATCTCTGCCCTCATG
Reviews

Customers who bought this product also purchased
FGC38517
FGC38517
FGC18958
FGC18958
PF2428
PF2428
PF2546
PF2546
M81
M81
Z21074
Z21074
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies